| >ENV08001591 | |
| Data type | Environmental sample (ENV) from GenBank |
| Sequence ID | >ENV08001591 |
| Genome ID | ABNJ01052532 |
| Phylum/Class | "mosquito metagenome; viral fraction from mixed species mosquitoes collected at Buena Vista Lagoon in Oceanside, CA" |
| Species | - |
| Start position | 76 |
| End position | 1 |
| Direction | - |
| Amino acid | Pro |
| Anticodon | TGG |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | CGGGGCATAGCGCAGTCTGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGAGGGTTCGAA TCCTTCTGCCCCGACCn |
| Upstream seq. | gcttctttnt |
| tRNA1-7 | CGGGGCA |
| tRNA8-9 | TA |
| tRNA10-13 | GCGC |
| tRNA14-21 | AGTCTGGTA |
| tRNA22-25 | GCGC |
| tRNA26 | A |
| tRNA27-31 | TCTGG |
| tRNA32-38 | TTTGGGA |
| tRNA39-43 | CCAGA |
| tRNA44-48 | GGGTC |
| tRNA49-53 | GAGGG |
| tRNA54-60 | TTCGAAT |
| tRNA61-65 | CCTTC |
| tRNA66-72 | TGCCCCG |
| tRNA73-76 | ACCn |
| Downstream seq. | nnnnnnnnnn |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | reliable tRNA gene |
| Comments | - |
| Original database | ENV division in DDBJ/EMBL/GenBank |