| >ENV08001610 | |
| Data type | Environmental sample (ENV) from GenBank |
| Sequence ID | >ENV08001610 |
| Genome ID | ABNJ01089745 |
| Phylum/Class | "mosquito metagenome; viral fraction from mixed species mosquitoes collected at Buena Vista Lagoon in Oceanside, CA" |
| Species | - |
| Start position | 23 |
| End position | 98 |
| Direction | + |
| Amino acid | Lys |
| Anticodon | TTT |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGGCTTTTAACCAATTGGTCGAAGGTTCGAAT CCTTCACGACCCACCA |
| Upstream seq. | aatattagat |
| tRNA1-7 | GGGTCGT |
| tRNA8-9 | TA |
| tRNA10-13 | GCTC |
| tRNA14-21 | AGTCGGTA |
| tRNA22-25 | GAGC |
| tRNA26 | A |
| tRNA27-31 | GTTGG |
| tRNA32-38 | CTTTTAA |
| tRNA39-43 | CCAAT |
| tRNA44-48 | TGGTC |
| tRNA49-53 | GAAGG |
| tRNA54-60 | TTCGAAT |
| tRNA61-65 | CCTTC |
| tRNA66-72 | ACGACCC |
| tRNA73-76 | ACCA |
| Downstream seq. | cttattactt |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | reliable tRNA gene |
| Comments | - |
| Original database | ENV division in DDBJ/EMBL/GenBank |