>ENV08001617 | |
Data type | Environmental sample (ENV) from GenBank |
Sequence ID | >ENV08001617 |
Genome ID | ABNJ01112088 |
Phylum/Class | "mosquito metagenome; viral fraction from mixed species mosquitoes collected at Buena Vista Lagoon in Oceanside, CA" |
Species | - |
Start position | 105 |
End position | 30 |
Direction | - |
Amino acid | Phe |
Anticodon | GAA |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | GGCCGAGTAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTTGTGTCGGCAGTTCGATT CTGTCCTCGGCCACCA |
Upstream seq. | nnnnnnncgt |
tRNA1-7 | GGCCGAG |
tRNA8-9 | TA |
tRNA10-13 | GCTC |
tRNA14-21 | AGTCGGTA |
tRNA22-25 | GAGC |
tRNA26 | A |
tRNA27-31 | GAGGA |
tRNA32-38 | TTGAAAA |
tRNA39-43 | TCCTT |
tRNA44-48 | GTGTC |
tRNA49-53 | GGCAG |
tRNA54-60 | TTCGATT |
tRNA61-65 | CTGTC |
tRNA66-72 | CTCGGCC |
tRNA73-76 | ACCA |
Downstream seq. | ccctgcccct |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | reliable tRNA gene |
Comments | - |
Original database | ENV division in DDBJ/EMBL/GenBank |