>ENV08001627 | |
Data type | Environmental sample (ENV) from GenBank |
Sequence ID | >ENV08001627 |
Genome ID | ABNJ01138625 |
Phylum/Class | "mosquito metagenome; viral fraction from mixed species mosquitoes collected at Buena Vista Lagoon in Oceanside, CA" |
Species | - |
Start position | 106 |
End position | 31 |
Direction | - |
Amino acid | Asn |
Anticodon | GTT |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | TCCCCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCAAGT CCAGTCAGGGGAGCCA |
Upstream seq. | nnnnnnnnnn |
tRNA1-7 | TCCCCTG |
tRNA8-9 | TA |
tRNA10-13 | GTTC |
tRNA14-21 | AGTCGGTA |
tRNA22-25 | GAAC |
tRNA26 | G |
tRNA27-31 | GCGGA |
tRNA32-38 | CTGTTAA |
tRNA39-43 | TCCGT |
tRNA44-48 | ATGTC |
tRNA49-53 | ACTGG |
tRNA54-60 | TTCAAGT |
tRNA61-65 | CCAGT |
tRNA66-72 | CAGGGGA |
tRNA73-76 | GCCA |
Downstream seq. | tattttctaa |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | reliable tRNA gene |
Comments | - |
Original database | ENV division in DDBJ/EMBL/GenBank |