>ENV08001676 | |
Data type | Environmental sample (ENV) from GenBank |
Sequence ID | >ENV08001676 |
Genome ID | ABNV01034095 |
Phylum/Class | "coral metagenome; microbial fraction from whole Porites compressa tissue extracts taken from a nutrient stressor experiment that consisted of 5 liters of ambient seawater with additional 10 mM excess of each: nitrate (Ca(NO3)2), nitrite (NaNO2), ammonium (NH4Cl), and phosphate (KH2PO4) that was changed every 24 hours; collected at 1 (n =9), 4 (n =9), 16 (n =9), and 64 (n =9) hours" |
Species | - |
Start position | 102 |
End position | 29 |
Direction | - |
Amino acid | Gly |
Anticodon | GCC |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | GCGGAAGTAGCTCATTTGGTAGAGCACGACCTTGCCAAGGTCGGGGTGGCCAGTTCGAGC CTGGTCTTCCGCTCag |
Upstream seq. | tcttagataa |
tRNA1-7 | GCGGAAG |
tRNA8-9 | TA |
tRNA10-13 | GCTC |
tRNA14-21 | ATTTGGTA |
tRNA22-25 | GAGC |
tRNA26 | A |
tRNA27-31 | CGACC |
tRNA32-38 | TTGCCAA |
tRNA39-43 | GGTCG |
tRNA44-48 | GGGTG |
tRNA49-53 | GCCAG |
tRNA54-60 | TTCGAGC |
tRNA61-65 | CTGGT |
tRNA66-72 | CTTCCGC |
tRNA73-76 | TCag |
Downstream seq. | ggtttcccgc |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | reliable tRNA gene |
Comments | - |
Original database | ENV division in DDBJ/EMBL/GenBank |