| >ENV08001676 | |
| Data type | Environmental sample (ENV) from GenBank |
| Sequence ID | >ENV08001676 |
| Genome ID | ABNV01034095 |
| Phylum/Class | "coral metagenome; microbial fraction from whole Porites compressa tissue extracts taken from a nutrient stressor experiment that consisted of 5 liters of ambient seawater with additional 10 mM excess of each: nitrate (Ca(NO3)2), nitrite (NaNO2), ammonium (NH4Cl), and phosphate (KH2PO4) that was changed every 24 hours; collected at 1 (n =9), 4 (n =9), 16 (n =9), and 64 (n =9) hours" |
| Species | - |
| Start position | 102 |
| End position | 29 |
| Direction | - |
| Amino acid | Gly |
| Anticodon | GCC |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GCGGAAGTAGCTCATTTGGTAGAGCACGACCTTGCCAAGGTCGGGGTGGCCAGTTCGAGC CTGGTCTTCCGCTCag |
| Upstream seq. | tcttagataa |
| tRNA1-7 | GCGGAAG |
| tRNA8-9 | TA |
| tRNA10-13 | GCTC |
| tRNA14-21 | ATTTGGTA |
| tRNA22-25 | GAGC |
| tRNA26 | A |
| tRNA27-31 | CGACC |
| tRNA32-38 | TTGCCAA |
| tRNA39-43 | GGTCG |
| tRNA44-48 | GGGTG |
| tRNA49-53 | GCCAG |
| tRNA54-60 | TTCGAGC |
| tRNA61-65 | CTGGT |
| tRNA66-72 | CTTCCGC |
| tRNA73-76 | TCag |
| Downstream seq. | ggtttcccgc |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | reliable tRNA gene |
| Comments | - |
| Original database | ENV division in DDBJ/EMBL/GenBank |