>ENV08001679 | |
Data type | Environmental sample (ENV) from GenBank |
Sequence ID | >ENV08001679 |
Genome ID | ABNY01001243 |
Phylum/Class | "saltern metagenome; microbial fraction from plasmids from marine microbial community in low salinity saltern in San Diego, CA" |
Species | - |
Start position | 4 |
End position | 76 |
Direction | + |
Amino acid | Trp |
Anticodon | CCA |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | GCGCTTTTAGTTCAGTTGGTAGAACGCAGGTCTCCAAAACCTGATGTCGAGGGTTCAAGT CCTTCAGGGCGTGtaa |
Upstream seq. | nnnnnnntaa |
tRNA1-7 | GCGCTTT |
tRNA8-9 | TA |
tRNA10-13 | GTTC |
tRNA14-21 | AGTTGGTA |
tRNA22-25 | GAAC |
tRNA26 | G |
tRNA27-31 | CAGGT |
tRNA32-38 | CTCCAAA |
tRNA39-43 | ACCTG |
tRNA44-48 | ATGTC |
tRNA49-53 | GAGGG |
tRNA54-60 | TTCAAGT |
tRNA61-65 | CCTTC |
tRNA66-72 | AGGGCGT |
tRNA73-76 | Gtaa |
Downstream seq. | taaaaaccaa |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | reliable tRNA gene |
Comments | - |
Original database | ENV division in DDBJ/EMBL/GenBank |