>ENV08001684 | |
Data type | Environmental sample (ENV) from GenBank |
Sequence ID | >ENV08001684 |
Genome ID | ABNY01007726 |
Phylum/Class | "saltern metagenome; microbial fraction from plasmids from marine microbial community in low salinity saltern in San Diego, CA" |
Species | - |
Start position | 117 |
End position | 44 |
Direction | - |
Amino acid | Gln |
Anticodon | TTG |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | TGGGGCATAGCCAAGCGGTAAGGCACGGGTTTTTGGTACCTGCATCCTAGGTTCGAATCC TAGCGCCCCAGCCA |
Upstream seq. | ngaaaaatat |
tRNA1-7 | TGGGGCA |
tRNA8-9 | TA |
tRNA10-13 | GCCA |
tRNA14-21 | AGCGGTA |
tRNA22-25 | AGGC |
tRNA26 | A |
tRNA27-31 | CGGGT |
tRNA32-38 | TTTTGGT |
tRNA39-43 | ACCTG |
tRNA44-48 | CATC |
tRNA49-53 | CTAGG |
tRNA54-60 | TTCGAAT |
tRNA61-65 | CCTAG |
tRNA66-72 | CGCCCCA |
tRNA73-76 | GCCA |
Downstream seq. | aatatgattt |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | reliable tRNA gene |
Comments | - |
Original database | ENV division in DDBJ/EMBL/GenBank |