| >ENV08001685 | |
| Data type | Environmental sample (ENV) from GenBank |
| Sequence ID | >ENV08001685 |
| Genome ID | ABNY01008451 |
| Phylum/Class | "saltern metagenome; microbial fraction from plasmids from marine microbial community in low salinity saltern in San Diego, CA" |
| Species | - |
| Start position | 23 |
| End position | 96 |
| Direction | + |
| Amino acid | Asp |
| Anticodon | GTC |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GCCTACGTGGTCCAACGGCTAAGACATATCCCTGTCGCGGATATAACCCGGGTTCAACTC CCGGCGTGGGCGTaa |
| Upstream seq. | gttattcaaT |
| tRNA1-7 | GCCTACG |
| tRNA8-9 | TG |
| tRNA10-13 | GTCC |
| tRNA14-21 | AACGGCTA |
| tRNA22-25 | AGAC |
| tRNA26 | A |
| tRNA27-31 | TATCC |
| tRNA32-38 | CTGTCGC |
| tRNA39-43 | GGATA |
| tRNA44-48 | TAAC |
| tRNA49-53 | CCGGG |
| tRNA54-60 | TTCAACT |
| tRNA61-65 | CCCGG |
| tRNA66-72 | CGTGGGC |
| tRNA73-76 | GTaa |
| Downstream seq. | ttcttataaa |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | reliable tRNA gene |
| Comments | - |
| Original database | ENV division in DDBJ/EMBL/GenBank |