>ENV08001698 | |
Data type | Environmental sample (ENV) from GenBank |
Sequence ID | >ENV08001698 |
Genome ID | ABNY01026275 |
Phylum/Class | "saltern metagenome; microbial fraction from plasmids from marine microbial community in low salinity saltern in San Diego, CA" |
Species | - |
Start position | 22 |
End position | 96 |
Direction | + |
Amino acid | His |
Anticodon | GTG |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | GCGGGTGTAGCCAAGTGGTTAAGGGCAGTGGGTTGTGGTTCCACTATTCGCGGGTTCGAT TCCCGTTACTCGCCCtt |
Upstream seq. | gtcatataag |
tRNA1-7 | GCGGGTG |
tRNA8-9 | TA |
tRNA10-13 | GCCA |
tRNA14-21 | AGTGGTTAA |
tRNA22-25 | GGGC |
tRNA26 | A |
tRNA27-31 | GTGGG |
tRNA32-38 | TTGTGGT |
tRNA39-43 | TCCAC |
tRNA44-48 | TATTC |
tRNA49-53 | GCGGG |
tRNA54-60 | TTCGATT |
tRNA61-65 | CCCGT |
tRNA66-72 | TACTCGC |
tRNA73-76 | CCtt |
Downstream seq. | tttgatatgt |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | reliable tRNA gene |
Comments | - |
Original database | ENV division in DDBJ/EMBL/GenBank |