| >ENV08001699 | |
| Data type | Environmental sample (ENV) from GenBank |
| Sequence ID | >ENV08001699 |
| Genome ID | ABNY01027832 |
| Phylum/Class | "saltern metagenome; microbial fraction from plasmids from marine microbial community in low salinity saltern in San Diego, CA" |
| Species | - |
| Start position | 101 |
| End position | 17 |
| Direction | - |
| Amino acid | Tyr |
| Anticodon | GTA |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GGCAAGTTACCCAAGCGGCCAAAGGGATCTGACTGTAAATCAGCCGGCGTAGCCTTCGGG GGTTCGAATCCCTCACTTGCCACAA |
| Upstream seq. | ctagcgcaat |
| tRNA1-7 | GGCAAGT |
| tRNA8-9 | TA |
| tRNA10-13 | CCCA |
| tRNA14-21 | AGCGGCCAA |
| tRNA22-25 | AGGG |
| tRNA26 | A |
| tRNA27-31 | TCTGA |
| tRNA32-38 | CTGTAAA |
| tRNA39-43 | TCAGC |
| tRNA44-48 | CGGCGTAGCCTTC |
| tRNA49-53 | GGGGG |
| tRNA54-60 | TTCGAAT |
| tRNA61-65 | CCCTC |
| tRNA66-72 | ACTTGCC |
| tRNA73-76 | ACAA |
| Downstream seq. | cgttgatagc |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | reliable tRNA gene |
| Comments | - |
| Original database | ENV division in DDBJ/EMBL/GenBank |