| >ENV08001703 | |
| Data type | Environmental sample (ENV) from GenBank |
| Sequence ID | >ENV08001703 |
| Genome ID | ABNY01030936 |
| Phylum/Class | "saltern metagenome; microbial fraction from plasmids from marine microbial community in low salinity saltern in San Diego, CA" |
| Species | - |
| Start position | 77 |
| End position | 2 |
| Direction | - |
| Amino acid | Ala |
| Anticodon | TGC |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GGGGATATTAGTATAGATGGGAAAACATCGCCCTTGCACGGCGAAGTCCGCGGTTCGATC CCGCGTATCTCCACCA |
| Upstream seq. | agaccaatta |
| tRNA1-7 | GGGGATA |
| tRNA8-9 | TT |
| tRNA10-13 | AGTA |
| tRNA14-21 | TAGATGGGA |
| tRNA22-25 | AAAC |
| tRNA26 | A |
| tRNA27-31 | TCGCC |
| tRNA32-38 | CTTGCAC |
| tRNA39-43 | GGCGA |
| tRNA44-48 | AGTC |
| tRNA49-53 | CGCGG |
| tRNA54-60 | TTCGATC |
| tRNA61-65 | CCGCG |
| tRNA66-72 | TATCTCC |
| tRNA73-76 | ACCA |
| Downstream seq. | tnnnnnnnnn |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | reliable tRNA gene |
| Comments | - |
| Original database | ENV division in DDBJ/EMBL/GenBank |