| >ENV08001908 | |
| Data type | Environmental sample (ENV) from GenBank |
| Sequence ID | >ENV08001908 |
| Genome ID | ABOK01003484 |
| Phylum/Class | "mosquito metagenome; viral fraction from Mung bean nuclease digestion of DNA from mixed species mosquitoes collected in Mission Valley in San Diego, CA" |
| Species | - |
| Start position | 39 |
| End position | 131 |
| Direction | + |
| Amino acid | Leu |
| Anticodon | TAA |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GCCCGGGTGGTGAAATTGGTAGACACAACGGACTTAAAATCCGTCGCTTACCGTAAAAGG GGCGTACCGGTTCGATTCCGGTCCCGGGCACCA |
| Upstream seq. | caagccatca |
| tRNA1-7 | GCCCGGG |
| tRNA8-9 | TG |
| tRNA10-13 | GTGA |
| tRNA14-21 | AATTGGTAG |
| tRNA22-25 | ACAC |
| tRNA26 | A |
| tRNA27-31 | ACGGA |
| tRNA32-38 | CTTAAAA |
| tRNA39-43 | TCCGT |
| tRNA44-48 | CGCTTACCGTAAAAGGGGCGT |
| tRNA49-53 | ACCGG |
| tRNA54-60 | TTCGATT |
| tRNA61-65 | CCGGT |
| tRNA66-72 | CCCGGGC |
| tRNA73-76 | ACCA |
| Downstream seq. | aaannnnnnn |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | reliable tRNA gene |
| Comments | - |
| Original database | ENV division in DDBJ/EMBL/GenBank |