| >ENV08001932 | |
| Data type | Environmental sample (ENV) from GenBank |
| Sequence ID | >ENV08001932 |
| Genome ID | ABOK01046212 |
| Phylum/Class | "mosquito metagenome; viral fraction from Mung bean nuclease digestion of DNA from mixed species mosquitoes collected in Mission Valley in San Diego, CA" |
| Species | - |
| Start position | 5 |
| End position | 80 |
| Direction | + |
| Amino acid | Asp |
| Anticodon | GTC |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GGATCGGTAGTTCAGTTGGTTAGAAATGCCGCCCTGTCACGGCGGAGGTCGCGGGTTCGA GTCCCGTCCGGTCCGCag |
| Upstream seq. | nnnnnnaaat |
| tRNA1-7 | GGATCGG |
| tRNA8-9 | TA |
| tRNA10-13 | GTTC |
| tRNA14-21 | AGTTGGTTAG |
| tRNA22-25 | AAAT |
| tRNA26 | G |
| tRNA27-31 | CCGCC |
| tRNA32-38 | CTGTCAC |
| tRNA39-43 | GGCGG |
| tRNA44-48 | AGGTC |
| tRNA49-53 | GCGGG |
| tRNA54-60 | TTCGAGT |
| tRNA61-65 | CCCGT |
| tRNA66-72 | CCGGTCC |
| tRNA73-76 | GCag |
| Downstream seq. | aaagtctcag |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | reliable tRNA gene |
| Comments | - |
| Original database | ENV division in DDBJ/EMBL/GenBank |