>ENV08001934 | |
Data type | Environmental sample (ENV) from GenBank |
Sequence ID | >ENV08001934 |
Genome ID | ABOK01050102 |
Phylum/Class | "mosquito metagenome; viral fraction from Mung bean nuclease digestion of DNA from mixed species mosquitoes collected in Mission Valley in San Diego, CA" |
Species | - |
Start position | 106 |
End position | 32 |
Direction | - |
Amino acid | Arg |
Anticodon | CCT |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | GTCCCCGTAGTTAAACGGATATAACAAGCCCCTCCTAAGGGCTAGTTACTGGTTCGATTC CAGTCGGGGACACCA |
Upstream seq. | ggtccgcagc |
tRNA1-7 | GTCCCCG |
tRNA8-9 | TA |
tRNA10-13 | GTTA |
tRNA14-21 | AACGGATA |
tRNA22-25 | TAAC |
tRNA26 | A |
tRNA27-31 | AGCCC |
tRNA32-38 | CTCCTAA |
tRNA39-43 | GGGCT |
tRNA44-48 | AGTT |
tRNA49-53 | ACTGG |
tRNA54-60 | TTCGATT |
tRNA61-65 | CCAGT |
tRNA66-72 | CGGGGAC |
tRNA73-76 | ACCA |
Downstream seq. | ttctttctca |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | reliable tRNA gene |
Comments | - |
Original database | ENV division in DDBJ/EMBL/GenBank |