>ENV08001939 | |
Data type | Environmental sample (ENV) from GenBank |
Sequence ID | >ENV08001939 |
Genome ID | ABOK01055049 |
Phylum/Class | "mosquito metagenome; viral fraction from Mung bean nuclease digestion of DNA from mixed species mosquitoes collected in Mission Valley in San Diego, CA" |
Species | - |
Start position | 23 |
End position | 96 |
Direction | + |
Amino acid | Cys |
Anticodon | GCA |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | AGCTGCATGGCCGAGTGGTTAGGTAAAGGTTTGCAAAACCTTTTACGCCAGTTCGATTCC GGCTGCAGCGTCAA |
Upstream seq. | cttttaactc |
tRNA1-7 | AGCTGCA |
tRNA8-9 | TG |
tRNA10-13 | GCCG |
tRNA14-21 | AGTGGTT |
tRNA22-25 | AGGT |
tRNA26 | A |
tRNA27-31 | AAGGT |
tRNA32-38 | TTGCAAA |
tRNA39-43 | ACCTT |
tRNA44-48 | TTAC |
tRNA49-53 | GCCAG |
tRNA54-60 | TTCGATT |
tRNA61-65 | CCGGC |
tRNA66-72 | TGCAGCG |
tRNA73-76 | TCAA |
Downstream seq. | agttgtttta |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | reliable tRNA gene |
Comments | - |
Original database | ENV division in DDBJ/EMBL/GenBank |