| >ENV08001960 | |
| Data type | Environmental sample (ENV) from GenBank |
| Sequence ID | >ENV08001960 |
| Genome ID | ABOK01092952 |
| Phylum/Class | "mosquito metagenome; viral fraction from Mung bean nuclease digestion of DNA from mixed species mosquitoes collected in Mission Valley in San Diego, CA" |
| Species | - |
| Start position | 9 |
| End position | 82 |
| Direction | + |
| Amino acid | Cys |
| Anticodon | GCA |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GGCGGGGTGGCAGAGTGGTCATGCAGCGGACTGCAACTCCGTGTACGCCGGTTCGATTCC GACCCCCGCCTCCA |
| Upstream seq. | nnacaccctt |
| tRNA1-7 | GGCGGGG |
| tRNA8-9 | TG |
| tRNA10-13 | GCAG |
| tRNA14-21 | AGTGGTC |
| tRNA22-25 | ATGC |
| tRNA26 | A |
| tRNA27-31 | GCGGA |
| tRNA32-38 | CTGCAAC |
| tRNA39-43 | TCCGT |
| tRNA44-48 | GTAC |
| tRNA49-53 | GCCGG |
| tRNA54-60 | TTCGATT |
| tRNA61-65 | CCGAC |
| tRNA66-72 | CCCCGCC |
| tRNA73-76 | TCCA |
| Downstream seq. | agttttcaag |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | reliable tRNA gene |
| Comments | - |
| Original database | ENV division in DDBJ/EMBL/GenBank |