>ENV08001975 | |
Data type | Environmental sample (ENV) from GenBank |
Sequence ID | >ENV08001975 |
Genome ID | ABOK01148089 |
Phylum/Class | "mosquito metagenome; viral fraction from Mung bean nuclease digestion of DNA from mixed species mosquitoes collected in Mission Valley in San Diego, CA" |
Species | - |
Start position | 100 |
End position | 25 |
Direction | - |
Amino acid | Val |
Anticodon | TAC |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | GGGTGATTAGCTCAGTTGGTAGAGCATCTCCTTTACACGGAGGGGGTCGGCGGTTCGAGC CCGTCATCACCCACCA |
Upstream seq. | ccacaacagt |
tRNA1-7 | GGGTGAT |
tRNA8-9 | TA |
tRNA10-13 | GCTC |
tRNA14-21 | AGTTGGTA |
tRNA22-25 | GAGC |
tRNA26 | A |
tRNA27-31 | TCTCC |
tRNA32-38 | TTTACAC |
tRNA39-43 | GGAGG |
tRNA44-48 | GGGTC |
tRNA49-53 | GGCGG |
tRNA54-60 | TTCGAGC |
tRNA61-65 | CCGTC |
tRNA66-72 | ATCACCC |
tRNA73-76 | ACCA |
Downstream seq. | ctgttatggg |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | reliable tRNA gene |
Comments | - |
Original database | ENV division in DDBJ/EMBL/GenBank |