| >ENV08001982 | |
| Data type | Environmental sample (ENV) from GenBank |
| Sequence ID | >ENV08001982 |
| Genome ID | ABOK01169651 |
| Phylum/Class | "mosquito metagenome; viral fraction from Mung bean nuclease digestion of DNA from mixed species mosquitoes collected in Mission Valley in San Diego, CA" |
| Species | - |
| Start position | 108 |
| End position | 22 |
| Direction | - |
| Amino acid | Leu |
| Anticodon | CAG |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GCCCAGGTGGCGGAATTGGTAGACGCGCTAGGTTCAGGTCCTAGTGGTGGTAACACTGTG GAGGTTCGAGTCCTCTCCTGGGCACCA |
| Upstream seq. | nnnnnnnnnt |
| tRNA1-7 | GCCCAGG |
| tRNA8-9 | TG |
| tRNA10-13 | GCGG |
| tRNA14-21 | AATTGGTAG |
| tRNA22-25 | ACGC |
| tRNA26 | G |
| tRNA27-31 | CTAGG |
| tRNA32-38 | TTCAGGT |
| tRNA39-43 | CCTAG |
| tRNA44-48 | TGGTGGTAACACTGT |
| tRNA49-53 | GGAGG |
| tRNA54-60 | TTCGAGT |
| tRNA61-65 | CCTCT |
| tRNA66-72 | CCTGGGC |
| tRNA73-76 | ACCA |
| Downstream seq. | gcagttttct |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | reliable tRNA gene |
| Comments | - |
| Original database | ENV division in DDBJ/EMBL/GenBank |