>ENV08002039 | |
Data type | Environmental sample (ENV) from GenBank |
Sequence ID | >ENV08002039 |
Genome ID | ABOL01024134 |
Phylum/Class | "mosquito metagenome; viral fraction from mixed species mosquitoes collected in Mission Valley in San Diego, CA" |
Species | - |
Start position | 98 |
End position | 27 |
Direction | - |
Amino acid | His |
Anticodon | GTG |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | GCCGGAATCGTCTAGTGGTTAGGACCCCACGTTGTGGCTGTGGTAACCTAGGTTCGAATC CTAGTTCCGGCAacg |
Upstream seq. | aaactcgatg |
tRNA1-7 | GCCGGAA |
tRNA8-9 | TC |
tRNA10-13 | GTCT |
tRNA14-21 | AGTGGTTA |
tRNA22-25 | GGAC |
tRNA26 | C |
tRNA27-31 | CCACG |
tRNA32-38 | TTGTGGC |
tRNA39-43 | TGTGG |
tRNA44-48 | TAAC |
tRNA49-53 | CTAGG |
tRNA54-60 | TTCGAAT |
tRNA61-65 | CCTAG |
tRNA66-72 | TTCCGGC |
tRNA73-76 | Aacg |
Downstream seq. | agattttttt |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | reliable tRNA gene |
Comments | - |
Original database | ENV division in DDBJ/EMBL/GenBank |