>ENV08002064 | |
Data type | Environmental sample (ENV) from GenBank |
Sequence ID | >ENV08002064 |
Genome ID | ABOL01058741 |
Phylum/Class | "mosquito metagenome; viral fraction from mixed species mosquitoes collected in Mission Valley in San Diego, CA" |
Species | - |
Start position | 44 |
End position | 118 |
Direction | + |
Amino acid | Arg |
Anticodon | CCT |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | GGTCCCGTAGTTCAATGGATAGAATAGAAGTTTCCTAAACTTTAGATACAAGTTCGATTC TTGTCGGGACTACCA |
Upstream seq. | cagcaggttt |
tRNA1-7 | GGTCCCG |
tRNA8-9 | TA |
tRNA10-13 | GTTC |
tRNA14-21 | AATGGATA |
tRNA22-25 | GAAT |
tRNA26 | A |
tRNA27-31 | GAAGT |
tRNA32-38 | TTCCTAA |
tRNA39-43 | ACTTT |
tRNA44-48 | AGAT |
tRNA49-53 | ACAAG |
tRNA54-60 | TTCGATT |
tRNA61-65 | CTTGT |
tRNA66-72 | CGGGACT |
tRNA73-76 | ACCA |
Downstream seq. | aagnnnnnnn |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | reliable tRNA gene |
Comments | - |
Original database | ENV division in DDBJ/EMBL/GenBank |