>ENV08002157 | |
Data type | Environmental sample (ENV) from GenBank |
Sequence ID | >ENV08002157 |
Genome ID | ABOL01346421 |
Phylum/Class | "mosquito metagenome; viral fraction from mixed species mosquitoes collected in Mission Valley in San Diego, CA" |
Species | - |
Start position | 79 |
End position | 4 |
Direction | - |
Amino acid | Ala |
Anticodon | TGC |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | GGGGCCATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCAACGGTTCGATC CCGTTTGGCTCCACCA |
Upstream seq. | gtagaaatat |
tRNA1-7 | GGGGCCA |
tRNA8-9 | TA |
tRNA10-13 | GCTC |
tRNA14-21 | AGCTGGGA |
tRNA22-25 | GAGC |
tRNA26 | G |
tRNA27-31 | CCTGC |
tRNA32-38 | CTTGCAC |
tRNA39-43 | GCAGG |
tRNA44-48 | AGGTC |
tRNA49-53 | AACGG |
tRNA54-60 | TTCGATC |
tRNA61-65 | CCGTT |
tRNA66-72 | TGGCTCC |
tRNA73-76 | ACCA |
Downstream seq. | ccannnnnnn |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | reliable tRNA gene |
Comments | - |
Original database | ENV division in DDBJ/EMBL/GenBank |