| >SRA1001665 | |
| Data type | Environmental sample (ENV) from Sequence Read Archive |
| Sequence ID | >SRA1001665 |
| Genome ID | SRR001077.26701 |
| Phylum/Class | "Coral Stressors, viral fraction from whole Porites compressa tissue extracts; Hawai'i Marine Laboratory Refuge Point Reef Corals (SRP000165)" |
| Species | - |
| Start position | 33 |
| End position | 106 |
| Direction | + |
| Amino acid | Pro |
| Anticodon | TGG |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | CGGGGTGTAGCTCAGTTTGGTAGAGCACTCGCTTTGGGAGCGAGTGGCCGAAGGTTCAAA TCCTTTCACCCCGAttt |
| Upstream seq. | actaccacta |
| tRNA1-7 | CGGGGTG |
| tRNA8-9 | TA |
| tRNA10-13 | GCTC |
| tRNA14-21 | AGTTTGGTA |
| tRNA22-25 | GAGC |
| tRNA26 | A |
| tRNA27-31 | CTCGC |
| tRNA32-38 | TTTGGGA |
| tRNA39-43 | GCGAG |
| tRNA44-48 | TGGCC |
| tRNA49-53 | GAAGG |
| tRNA54-60 | TTCAAAT |
| tRNA61-65 | CCTTT |
| tRNA66-72 | CACCCCG |
| tRNA73-76 | Attt |
| Downstream seq. | ttcttatnnn |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | - |
| Comments | - |
| Original database | - |