| >SRA1005432 | |
| Data type | Environmental sample (ENV) from Sequence Read Archive |
| Sequence ID | >SRA1005432 |
| Genome ID | SRR013521.4214 |
| Phylum/Class | Viral metagenome of the Antarctic Lake Limnopolar in spring and summer? (SRP000593) |
| Species | - |
| Start position | 252 |
| End position | 172 |
| Direction | - |
| Amino acid | Leu |
| Anticodon | TAG |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GCGCGAATGTCCGAGTGGTTAAGGAGCTAGATTTAGGCTCTAGTGTCGAAAGGCTCGCAG GTTCAAATCCTGCTTCGCGCAtct |
| Upstream seq. | ncctagttaa |
| tRNA1-7 | GCGCGAA |
| tRNA8-9 | TG |
| tRNA10-13 | TCCG |
| tRNA14-21 | AGTGGTTA |
| tRNA22-25 | AGGA |
| tRNA26 | G |
| tRNA27-31 | CTAGA |
| tRNA32-38 | TTTAGGC |
| tRNA39-43 | TCTAG |
| tRNA44-48 | TGTCGAAAGGCTC |
| tRNA49-53 | GCAGG |
| tRNA54-60 | TTCAAAT |
| tRNA61-65 | CCTGC |
| tRNA66-72 | TTCGCGC |
| tRNA73-76 | Atct |
| Downstream seq. | ggttcgttag |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | - |
| Comments | - |
| Original database | - |