| >SRA1005434 | |
| Data type | Environmental sample (ENV) from Sequence Read Archive |
| Sequence ID | >SRA1005434 |
| Genome ID | SRR013521.4453 |
| Phylum/Class | Viral metagenome of the Antarctic Lake Limnopolar in spring and summer? (SRP000593) |
| Species | - |
| Start position | 145 |
| End position | 222 |
| Direction | + |
| Amino acid | Met |
| Anticodon | CAT |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GTCGGCGTAGCTCAGTTGGTTAGAGCGCGGGACTCATAAGCCCGAGGTCGGAGGATCGTT CCCTCCCGCCGACACCC |
| Upstream seq. | acacgtacaT |
| tRNA1-7 | GTCGGCG |
| tRNA8-9 | TA |
| tRNA10-13 | GCTC |
| tRNA14-21 | AGTTGGTTA |
| tRNA22-25 | GAGC |
| tRNA26 | G |
| tRNA27-31 | CGGGA |
| tRNA32-38 | CTCATAA |
| tRNA39-43 | GCCCG |
| tRNA44-48 | AGGTC |
| tRNA49-53 | GGAGG |
| tRNA54-60 | ATCGTTC |
| tRNA61-65 | CCTCC |
| tRNA66-72 | CGCCGAC |
| tRNA73-76 | ACCC |
| Downstream seq. | ttagtttttt |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | - |
| Comments | - |
| Original database | - |