>SRA1016592 | |
Data type | Environmental sample (ENV) from Sequence Read Archive |
Sequence ID | >SRA1016592 |
Genome ID | SRR027364.17874 |
Phylum/Class | Analysis of diversity of coastal microbial mats using 454 technology (SRP001219) |
Species | - |
Start position | 153 |
End position | 79 |
Direction | - |
Amino acid | Gly |
Anticodon | CCC |
1st Intron start position | 0 |
1st Intron end position | 0 |
Seq. | GCGGGCGTAGCTCAGTGGTAGAGCAGAAGCTTCCCAAGCTTCGTGTCGAGGGTTCGATTC CCTTCTCCCGCTCCA |
Upstream seq. | accggcgggc |
tRNA1-7 | GCGGGCG |
tRNA8-9 | TA |
tRNA10-13 | GCTC |
tRNA14-21 | AGTGGTA |
tRNA22-25 | GAGC |
tRNA26 | A |
tRNA27-31 | GAAGC |
tRNA32-38 | TTCCCAA |
tRNA39-43 | GCTTC |
tRNA44-48 | GTGTC |
tRNA49-53 | GAGGG |
tRNA54-60 | TTCGATT |
tRNA61-65 | CCCTT |
tRNA66-72 | CTCCCGC |
tRNA73-76 | TCCA |
Downstream seq. | actttcattt |
1st Intron seq. | - |
2nd Intron start position | - |
2nd Intron end position | - |
2st Intron seq. | - |
Decision from Dr. Muto | - |
Decision from Dr. Inokuchi | - |
Decision from Dr. Yamada | - |
Comment of Dr. Muto | - |
Comment of Dr. Inokuchi | - |
Comment of Dr. Yamada | - |
Final decision | - |
Comments | - |
Original database | - |