| >SRA1016605 | |
| Data type | Environmental sample (ENV) from Sequence Read Archive |
| Sequence ID | >SRA1016605 |
| Genome ID | SRR027367.12583 |
| Phylum/Class | Analysis of diversity of coastal microbial mats using 454 technology (SRP001219) |
| Species | - |
| Start position | 122 |
| End position | 47 |
| Direction | - |
| Amino acid | Ala |
| Anticodon | GGC |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GGGGGGTTAGCTCAGTTGGGAGAGCGCCTGAATGGCATTCAGGAGGTCGAGGGTTCAACT CCCTTACCCTCCACCA |
| Upstream seq. | ccaccttgat |
| tRNA1-7 | GGGGGGT |
| tRNA8-9 | TA |
| tRNA10-13 | GCTC |
| tRNA14-21 | AGTTGGGA |
| tRNA22-25 | GAGC |
| tRNA26 | G |
| tRNA27-31 | CCTGA |
| tRNA32-38 | ATGGCAT |
| tRNA39-43 | TCAGG |
| tRNA44-48 | AGGTC |
| tRNA49-53 | GAGGG |
| tRNA54-60 | TTCAACT |
| tRNA61-65 | CCCTT |
| tRNA66-72 | ACCCTCC |
| tRNA73-76 | ACCA |
| Downstream seq. | tcttttccgg |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | - |
| Comments | - |
| Original database | - |