| >SRA1016632 | |
| Data type | Environmental sample (ENV) from Sequence Read Archive |
| Sequence ID | >SRA1016632 |
| Genome ID | SRR027369.38678 |
| Phylum/Class | Analysis of diversity of coastal microbial mats using 454 technology (SRP001219) |
| Species | - |
| Start position | 252 |
| End position | 179 |
| Direction | - |
| Amino acid | Glu |
| Anticodon | CTC |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GCCCCCTTCGTCTAGTGGCCCAGGACACTGGATTCTCAGTCCAGAAACAGCAGTTCGAAT CTGTTAGGGGGTACtg |
| Upstream seq. | nnnnnnnncc |
| tRNA1-7 | GCCCCCT |
| tRNA8-9 | TC |
| tRNA10-13 | GTCT |
| tRNA14-21 | AGTGGCCCA |
| tRNA22-25 | GGAC |
| tRNA26 | A |
| tRNA27-31 | CTGGA |
| tRNA32-38 | TTCTCAG |
| tRNA39-43 | TCCAG |
| tRNA44-48 | AAAC |
| tRNA49-53 | AGCAG |
| tRNA54-60 | TTCGAAT |
| tRNA61-65 | CTGTT |
| tRNA66-72 | AGGGGGT |
| tRNA73-76 | ACtg |
| Downstream seq. | ttgatgcagc |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | - |
| Comments | - |
| Original database | - |