| >SRA1016637 | |
| Data type | Environmental sample (ENV) from Sequence Read Archive |
| Sequence ID | >SRA1016637 |
| Genome ID | SRR027369.43421 |
| Phylum/Class | Analysis of diversity of coastal microbial mats using 454 technology (SRP001219) |
| Species | - |
| Start position | 153 |
| End position | 228 |
| Direction | + |
| Amino acid | Thr |
| Anticodon | CGT |
| 1st Intron start position | 0 |
| 1st Intron end position | 0 |
| Seq. | GCCGCTGTAGCTCAGCTGGTAGAGCACGTCATTCGTAATGATGGGGTCGGGGGTTCGAGT CCCTTCAGCGGCACCA |
| Upstream seq. | gcgcccgggc |
| tRNA1-7 | GCCGCTG |
| tRNA8-9 | TA |
| tRNA10-13 | GCTC |
| tRNA14-21 | AGCTGGTA |
| tRNA22-25 | GAGC |
| tRNA26 | A |
| tRNA27-31 | CGTCA |
| tRNA32-38 | TTCGTAA |
| tRNA39-43 | TGATG |
| tRNA44-48 | GGGTC |
| tRNA49-53 | GGGGG |
| tRNA54-60 | TTCGAGT |
| tRNA61-65 | CCCTT |
| tRNA66-72 | CAGCGGC |
| tRNA73-76 | ACCA |
| Downstream seq. | cttgtccata |
| 1st Intron seq. | - |
| 2nd Intron start position | - |
| 2nd Intron end position | - |
| 2st Intron seq. | - |
| Decision from Dr. Muto | - |
| Decision from Dr. Inokuchi | - |
| Decision from Dr. Yamada | - |
| Comment of Dr. Muto | - |
| Comment of Dr. Inokuchi | - |
| Comment of Dr. Yamada | - |
| Final decision | - |
| Comments | - |
| Original database | - |