| -141NTG13 | |
| Identifier | -141NTG13 |
| Accession number | S000335 |
| Date (operation) author | 16-Feb-2001 (last modified) seki |
| Description | "-141 sequence"; Binding site of tobacco (N.t.) TGA1a-related protein,PG13, found in the G13 gene promoter; PG13 (Protein encoded by G13) shows high homology to TGA1a; ASF-1, PG13, and TGA1a bind to the same target sequence in the 5' upstream region of G13 suggesting that autoregulation of transcription may involved in the control of G13 expression; TGA1a is preferentially expressed in root tip meristems; TGA1a may contribute to the expression of GST isoenzymes, especially in root tip meristems; |
| Keywords | TGA1a; G13; ASF1; ASF-1; bZip; xenobiotic stress; root; meristem; |
| Species | tobacco (Nicotiana tabacum) |
| Sequence | GCTTTTGATGACTTCAAACAC |
| Reference | references |