| -284MOTIFZMSBE1 | |
| Identifier | -284MOTIFZMSBE1 |
| Accession number | S000285 |
| Date (operation) author | 10-Feb-2000 (last modified) seki |
| Description | Located between -284 and -255 region of maize (Z.m.) Sbe1 gene promoter; Critical positive cis element; Important for the high-level, sugar-responsive expression of the Sbe1 gene in maize endosperm cells; Recognized by nuclear protein; See S000284; |
| Keywords | Starch-branching enzyme (Sbe1); starch; kernel; sugar; endosperm; seed; |
| Species | maize (Zea mays) |
| Sequence | CGTGCAAGCCCAAAGGCCAATCGGCCCAGA |
| Reference | references |