| 23BPUASNSCYCB1 | |
| Identifier | 23BPUASNSCYCB1 |
| Accession number | S000283 |
| Date (operation) author | 10-Feb-2000 (last modified) seki |
| Description | "23 bp UAS (Upstream activating sequence)" found in the promoter of Nicotiana sylvestris (N.s.) CycB1 gene; Located between -386 and -409; Contains a 5 bp element identical to the MYB binding core (ACGT); Required for M-phase-specific expression; Binds protein complexes in a cell cycle-regulated manner; |
| Keywords | B-type cyclins; MYB; Cell cycle; M-phase; |
| Species | tobacco (Nicotiana sylvestris) |
| Sequence | TTTATTTACCAAACGGTAACATC |
| Reference | references |