| AS1CAMV | |
| Identifier | AS1CAMV |
| Accession number | S000023 |
| Date (operation) author | 16-Jan-1998 (last modified) kehi |
| Description | "as-1 (activation sequence 1)" in CaMV 35S promoter; from -85 to -58 (subdomain AI); Binding with ASF-1 (activation sequence factor 1) from pea and tobacco; Expression in root and leaf; |
| Keywords | CaMV 35S promoter; ASF-1; leaf; root; as-1; |
| Species | Cauliflower mosaic virus; CaMV; |
| Sequence | CCACTGACGTAAGGGATGACGCACAATCC |
| Reference | references |