| CGF1ATCAB2 | |
| Identifier | CGF1ATCAB2 |
| Accession number | S000213 |
| Date (operation) author | 11-May-2006 (last modified) kehi |
| Description | CGF-1 binding site in the Arabidopsis (A.t.) cab2 gene promoter; CGF-1=CAB GATA Factor 1; Found at -74 to -42; Contains a highly conserved, repeated GATA motif termed I-box (see S000124, S000199); For GATA motif, see S000039; The binding specificity of CGF-1 appears to be related to GT-family of DNA-binding proteins; For a compilation of related GT elements and factors, see Villain et al. (1996); |
| Keywords | CGF; cab; cab2; CGF-1; GT; leaf; shoot; |
| Species | Arabidopsis thaliana; |
| Sequence | GATAAAGATTACTTCAGATATAACAAACGTTAC |
| Reference | references |