| EIN3ATERF1 | |
| Identifier | EIN3ATERF1 |
| Accession number | S000332 |
| Date (operation) author | 7-Sep-2000 (last modified) seki |
| Description | EIN3 (Ethylene-insensitive 3) binding site found in the promoter of the Arabidopsis (A.t.) ERF1 (Ethylene-Response-Factor 1); EIN3 recognizes its target as a homodimer; EIN3 is necessary and sufficient for ERF1 expression; Consititutive expression of ERF1 results in the activation of a variety of ethylene response genes and phenotype; ERF1 is a GCC-box binding site; ERF1 acts downstream of EIN3; |
| Keywords | EIN3; ERF1; Ethylene; |
| Species | Arabidopsis thaliana |
| Sequence | GGATTCAAGGGGCATGTATCTTGAATCC |
| Reference | references |