| ELEMENT1GMLBC3 | |
| Identifier | ELEMENT1GMLBC3 |
| Accession number | S000319 |
| Date (operation) author | 7-Sep-2000 (last modified) seki |
| Description | "Element 1" found in the promoter of soybean (G.m.) leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Located at -223 to -246; Element 1 and Element 2 (S000320) bind to the same nodule specific factor; Element 1 and Element 2 share a common motif; See S000320; |
| Keywords | nodule; leghaemoglobin; lbc3; root; |
| Species | Soybean (Glycine max) |
| Sequence | GATATATTAATATTTTATTTTATA |
| Reference | references |