JERECRSTR
Identifier JERECRSTR
Accession number S000384
Date (operation) author 21-Nov-2002 (last modified) uchi
Description "JERE" (jasmonate- and elicitor-responsive element) found in the periwinkle(C.R.) strictosidine synthase(Str) gene promoter; Located between -100 and -58; ORCA1, ORCA2 and ORCA3 bind specifically to the JERE of the Str promoter; Elicitor and MeJA rapidly induce Orca2, but not Orca1 mRNA levels; ORCA3 mRNA accumulation was rapidly induced by the metyljasmonate;
Keywords JERE; JA; jasmonate; elicitor; strictosidine synthase(Str); ORCA1; ORCA2; ORCA3; AP2 domain;
Species periwinkle(Catharanthus roseus)
Sequence
CTCTTAGACCGCCTTCTTTGAAAG
Reference references