| OBF5ATGST6 | |
| Identifier | OBF5ATGST6 |
| Accession number | S000304 |
| Date (operation) author | 29-Sep-2003 (last modified) kehi |
| Description | "OBF5 (ocs element binding factor 5)" binding site found in the Arabidopsis (A.t.) GST6 gene promoter; Similar to Ocs sequence; Located between -426 and -401; See S000305; Overexpression of OBP3 lead to severe growth defect with altered root development and yellowish leaves; All OBP proteins contain transcriptional activation domains in their C-terminal region; Dof protein play important roles in plant growth and development; Binding site of OBF4 and OBF5; See S000305, S000346; |
| Keywords | GST; Ocs; OBF; OBP; auxin; SA; cycloheximide, Dof; TGA; pathogen; root; leaf; shoot; |
| Species | Arabidopsis (Arabidopsis thaliana) |
| Sequence | ATCTTATGTCATTGATGACGACCTCC |
| Reference | references |