| BP918515 |
| Clone id |
YMU001_000114_D08 |
| Library |
YMU01 |
| Length |
122 |
| Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000114_D08. |
| Accession |
BP918515 |
| Tissue type |
prothallium |
| Developmental stage |
- |
| Contig ID |
CL2690Contig1 |
| Sequence |
TAGCAGGGGAGGACTTTGCGTCATCATTAGGGGCAAAATGGGCTGCCCAGCAAGAGGTTG GTGGACTTGATGTGAAGGCGAACTCGGGTACCAATGGTGGTGCCCATGGTATATCAAAGC AT |
| ■■Homology search results ■■ |
- |
| Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
| sp_hit_id |
O08617 |
| Definition |
sp|O08617|PTPRR_RAT Receptor-type tyrosine-protein phosphatase R OS=Rattus norvegicus |
| Align length |
29 |
| Score (bit) |
30.4 |
| E-value |
2.9 |
| Report |
 |
| TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
| tr_hit_id |
- |
| Definition |
No hits. |
| Align length |
- |
| Score (bit) |
- |
| E-value |
- |
| Report |
 |