CL2690Contig1
Contig ID CL2690Contig1
Length 521
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2690contig1 sequence.
Clone ID BP918515 BP913964
Sequence
TAGCAGGGGAGGACTTTGCGTCATCATTAGGGGCAAAATGGGCTGCCCAGCAAGAGGTTG
GTGGACTTGATGTGAAGGCGAACTCGGGTACCAATGGTGGTGCCCATGGTATATCAAAGC
ATGGTGGATGGCATTCTGGTGAGAATGAGAAGTGGGTGGTGAAACAAGGTCCCTTTTTGG
GAGTTATGATATGTAATCATAAATGCAAGACTGTCCGGTGTTTGGAGTCACAAGTAATGG
CTCCCTCGGCAGAGCCGGATGACAGAATGCTTGACCTTTTGATGGTTCACAATGTTGGTC
GCCTCCGGCTTATCCAGTTCCTAGTTCTCATGCAGTTTGGTCGTCACATGTCATTACCTT
TTGTAGAGTATGTAAAGGTGCATTCAGTGAAATTGAAGCCAGGAAATAAAAGTAACATAG
GTTGTGGAATTGATGGGGAGTTGATGCCGCTCAATGGCCCGATATCAGTTACGCTACTGG
AGGATCAGCATCAACTTATTGGGTCTTCTGCAACCGGTGCC