DK943520 [AcEST]

DK943520
Clone id	YMU02A01NGRL0003_B13
Library	YMU02
Length	206
Definition	Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0003_B13. 5' end sequence.
Accession	DK943520
Tissue type	young leaves
Developmental stage	sporophyte
Contig ID	CL1Contig3
Sequence	GGTAGACGTCTAAGATAGCTGACTCATCGTCACTAAACCTCAGAGAATAAATCTGGGAAA GAAAGTTGGAATAAATAAATCCGGGTTTGTCAAGATTATTGAACATCTATTTGGTTGAAC GGGATCCCTCGTTTCAACAACTCGGTGAGATATATTTCCCTAAGGGTTTTTTCACAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAA
■■Homology search results ■■	-
Swiss-Prot (release 56.9)	Link to BlastX Result : Swiss-Prot
sp_hit_id	-
Definition	No hits.
Align length	-
Score (bit)	-
E-value	-
Report	BLASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= DK943520\|Adiantum capillus-veneris mRNA, clone: YMU02A01NGRL0003_B13, 5' (175 letters) Database: uniprot_sprot.fasta 412,525 sequences; 148,809,765 total letters Searching..................................................done *** No hits found ****
TrEMBL (release 39.9)	Link to BlastX Result : TrEMBL
tr_hit_id	-
Definition	No hits.
Align length	-
Score (bit)	-
E-value	-
Report	BLASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= DK943520\|Adiantum capillus-veneris mRNA, clone: YMU02A01NGRL0003_B13, 5' (175 letters) Database: uniprot_trembl.fasta 7,341,751 sequences; 2,391,615,440 total letters Searching..................................................done *** No hits found ****