| DK943989 |
| Clone id |
YMU02A01NGRL0004_J24 |
| Library |
YMU02 |
| Length |
184 |
| Definition |
Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0004_J24. 5' end sequence. |
| Accession |
DK943989 |
| Tissue type |
young leaves |
| Developmental stage |
sporophyte |
| Contig ID |
CL223Contig1 |
| Sequence |
GACAAAAAAGGTTATGGATACAAGAGATGAAAAACCCAATACAAAAAGTCACCTTTCAAT TTATCATGACCTGCAGTCTGCCAGAATCATTCGCTATTGTTCCATTGGTTTCCAAATGGA TATATAGATTCGAAATCTCAAAGAATAAGAATAAAAAAATATTACACACCGTTACGGCCT ATCC |
| ■■Homology search results ■■ |
- |
| Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
| sp_hit_id |
Q49WB0 |
| Definition |
sp|Q49WB0|CDR_STAS1 Coenzyme A disulfide reductase OS=Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229) |
| Align length |
26 |
| Score (bit) |
29.3 |
| E-value |
6.3 |
| Report |
 |
| TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
| tr_hit_id |
- |
| Definition |
No hits. |
| Align length |
- |
| Score (bit) |
- |
| E-value |
- |
| Report |
 |