DK944021
Clone id YMU02A01NGRL0004_L18
Library
Length 486
Definition Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0004_L18. 5' end sequence.
Accession
Tissue type young leaves
Developmental stage sporophyte
Contig ID
Sequence
AAGCACTCGACAGTACCATCAAGTGTTAGTCATGGCTTCTAAGAAGATAACGTGCATGCT
GGTGATAGTGATGGTGATGCTGGTGGCATACATGAGCAGCGTTGCTAATGCTGAGGTGGA
GGAAGTGGGGCGTAAATTAGTGGCTGGGGCAGGGGCAGAAGCAGGTGAGGAGGCCGAGTT
GTGGGCCAAGAAAGGTCATTACCCTTACAAGAAAGGGTACAAGAAGGGCGGCTACCACCA
CAAGAAGGGCGGCGGCTACGGCAAGGGTCCGGGCCACCCTCACTAACTCAAGGCAGCTGC
TTCGTCCGAGCGCGTCTTCTGTCCGATTCTTGGGTTTATCCACCCCAGACGCGCGTTCCT
TGTGAAATAGATAATACGGTGTCAGCACTGAAGTGTTAAAATTGTCTTTGTTGTTGCAAC
CTGTGTACCTTATGGGAATTCATTTGCTGGTTTAACTTCTGACAAAAAAAAAAAAAAAAA
AAAAAA
■■Homology search results ■■ -
sp_hit_id Q54F40
Definition sp|Q54F40|Y1133_DICDI Probable serine/threonine-protein kinase DDB_G0291133 OS=Dictyostelium discoideum
Align length 21
Score (bit) 29.6
E-value 6.7
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= DK944021|Adiantum capillus-veneris mRNA, clone:
YMU02A01NGRL0004_L18, 5'
(463 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

sp|Q54F40|Y1133_DICDI Probable serine/threonine-protein kinase D... 30 6.7
sp|Q6ZS49|YQ050_HUMAN Putative uncharacterized protein FLJ45831 ... 29 8.7

>sp|Q54F40|Y1133_DICDI Probable serine/threonine-protein kinase
DDB_G0291133 OS=Dictyostelium discoideum GN=DDB_G0291133
PE=3 SV=1
Length = 778

Score = 29.6 bits (65), Expect = 6.7
Identities = 10/21 (47%), Positives = 16/21 (76%)
Frame = -1

Query: 415 NNKDNFNTSVLTPYYLFHKER 353
NN +N+N ++TPY+ + KER
Sbjct: 510 NNINNYNLKLITPYFQYQKER 530


>sp|Q6ZS49|YQ050_HUMAN Putative uncharacterized protein FLJ45831
OS=Homo sapiens PE=5 SV=1
Length = 121

Score = 29.3 bits (64), Expect = 8.7
Identities = 14/23 (60%), Positives = 15/23 (65%)
Frame = -1

Query: 397 NTSVLTPYYLFHKERASGVDKPK 329
N S L PYYLFH+ R GVD K
Sbjct: 69 NASKLMPYYLFHRSR--GVDNSK 89


tr_hit_id Q9FCG8
Definition tr|Q9FCG8|Q9FCG8_STRCO Putative uncharacterized protein SCO4201 OS=Streptomyces coelicolor
Align length 39
Score (bit) 32.7
E-value 9.1
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= DK944021|Adiantum capillus-veneris mRNA, clone:
YMU02A01NGRL0004_L18, 5'
(463 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

tr|Q9FCG8|Q9FCG8_STRCO Putative uncharacterized protein SCO4201 ... 33 9.1
tr|B5HLR9|B5HLR9_9ACTO Magnesium or manganese-dependent protein ... 33 9.1

>tr|Q9FCG8|Q9FCG8_STRCO Putative uncharacterized protein SCO4201
OS=Streptomyces coelicolor GN=SCO4201 PE=4 SV=1
Length = 544

Score = 32.7 bits (73), Expect = 9.1
Identities = 18/39 (46%), Positives = 23/39 (58%)
Frame = +1

Query: 181 VGQERSLPLQERVQEGRLPPQEGRRLRQGSGPPSLTQGS 297
V ++RS + R+ EGRL QE RRL +G P L GS
Sbjct: 281 VERKRSDSAERRLAEGRLRAQENRRLERGLLPTPLLAGS 319


>tr|B5HLR9|B5HLR9_9ACTO Magnesium or manganese-dependent protein
phosphatase OS=Streptomyces sviceus ATCC 29083
GN=SSEG_00354 PE=4 SV=1
Length = 478

Score = 32.7 bits (73), Expect = 9.1
Identities = 17/39 (43%), Positives = 24/39 (61%)
Frame = +1

Query: 181 VGQERSLPLQERVQEGRLPPQEGRRLRQGSGPPSLTQGS 297
V ++RS + R+ EGR+ QE RRL +G P L +GS
Sbjct: 215 VERKRSDTAERRLAEGRVRAQENRRLERGLLPTPLLEGS 253