DK944027
Clone id YMU02A01NGRL0004_M02
Library
Length 237
Definition Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0004_M02. 5' end sequence.
Accession
Tissue type young leaves
Developmental stage sporophyte
Contig ID
Sequence
GAACTTATGCGGCTTGTGAAAGTCAAGGAGGAGTTGCAGGCAAAGGCAGAAGCTCTTGAT
GAACCCACCATTACTCGTCTAGGTGACCCGCTGTGCAAAAAAGACGATTCTGTTCGAAGC
TGAAATCGCTGCAGAAGGCCTACAAGGTGCTGTAAGGGTTTAGGAAATGAGAAACTGGTT
TCTGTAATCGTCAGAAGCATTGCACTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
■■Homology search results ■■ -
sp_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= DK944027|Adiantum capillus-veneris mRNA, clone:
YMU02A01NGRL0004_M02, 5'
(208 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done

***** No hits found ******


tr_hit_id B4KLF1
Definition tr|B4KLF1|B4KLF1_DROMO GI17886 OS=Drosophila mojavensis
Align length 32
Score (bit) 32.7
E-value 9.1
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= DK944027|Adiantum capillus-veneris mRNA, clone:
YMU02A01NGRL0004_M02, 5'
(208 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

tr|B4KLF1|B4KLF1_DROMO GI17886 OS=Drosophila mojavensis GN=GI178... 33 9.1
tr|B3N3T8|B3N3T8_DROER GG24368 OS=Drosophila erecta GN=GG24368 P... 33 9.1

>tr|B4KLF1|B4KLF1_DROMO GI17886 OS=Drosophila mojavensis GN=GI17886
PE=4 SV=1
Length = 7357

Score = 32.7 bits (73), Expect = 9.1
Identities = 14/32 (43%), Positives = 21/32 (65%)
Frame = -2

Query: 207 ECNASDDYRNQFLIS*TLTAPCRPSAAISASN 112
+C+AS+ RN ++ L +PC P+AA S SN
Sbjct: 3012 DCSASESCRNDKCVNPCLESPCGPNAACSVSN 3043


>tr|B3N3T8|B3N3T8_DROER GG24368 OS=Drosophila erecta GN=GG24368 PE=4
SV=1
Length = 4310

Score = 32.7 bits (73), Expect = 9.1
Identities = 14/32 (43%), Positives = 21/32 (65%)
Frame = -2

Query: 207 ECNASDDYRNQFLIS*TLTAPCRPSAAISASN 112
+C+AS+ RN ++ L +PC P+AA S SN
Sbjct: 3014 DCSASESCRNDKCVNPCLESPCGPNAACSVSN 3045