DK944117 | |
Clone id | YMU02A01NGRL0005_A12 |
Library | YMU02 |
Length | 328 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0005_A12. 5' end sequence. |
Accession | DK944117 |
Tissue type | young leaves |
Developmental stage | sporophyte |
Contig ID | - |
Sequence | GTAGCCAAAATTCTGAGGGGCCAAACAATGAAGATCTCGTGAAGGACACTGAAGCACTCT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q5R5P4 |
Definition | sp|Q5R5P4|RBM47_PONAB RNA-binding protein 47 OS=Pongo abelii |
Align length | 31 |
Score (bit) | 30.0 |
E-value | 3.8 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q970S2 |
Definition | tr|Q970S2|Q970S2_SULTO Putative uncharacterized protein ST1530 OS=Sulfolobus tokodaii |
Align length | 47 |
Score (bit) | 35.4 |
E-value | 1.4 |
Report | BLASTX 2.2.19 [Nov-02-2008] |