DK944200 | |
Clone id | YMU02A01NGRL0005_E18 |
Library | YMU02 |
Length | 232 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0005_E18. 5' end sequence. |
Accession | DK944200 |
Tissue type | young leaves |
Developmental stage | sporophyte |
Contig ID | - |
Sequence | GCAACCCGCTTTGGAGCGTTCTACCTCCTCCCCCCTCACATCATCCCGCCTCTCAATATG |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q759T1 |
Definition | sp|Q759T1|SNX41_ASHGO Sorting nexin-41 OS=Ashbya gossypii |
Align length | 43 |
Score (bit) | 29.6 |
E-value | 4.9 |
Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |