| DK944200 | |
| Clone id | YMU02A01NGRL0005_E18 |
| Library | YMU02 |
| Length | 232 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0005_E18. 5' end sequence. |
| Accession | DK944200 |
| Tissue type | young leaves |
| Developmental stage | sporophyte |
| Contig ID | - |
| Sequence | GCAACCCGCTTTGGAGCGTTCTACCTCCTCCCCCCTCACATCATCCCGCCTCTCAATATG |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q759T1 |
| Definition | sp|Q759T1|SNX41_ASHGO Sorting nexin-41 OS=Ashbya gossypii |
| Align length | 43 |
| Score (bit) | 29.6 |
| E-value | 4.9 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | - |
| Definition | No hits. |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |