DK944425 |
Clone id |
YMU02A01NGRL0006_A09 |
Library |
YMU02 |
Length |
120 |
Definition |
Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0006_A09. 5' end sequence. |
Accession |
DK944425 |
Tissue type |
young leaves |
Developmental stage |
sporophyte |
Contig ID |
- |
Sequence |
ACTTTGACTGCCTCCTAACTTATAATTATCGATCTCGCCTGCCGAGATAGGTATCGATCT CCCTCCTATCTTTTCCTTCACAGACCGCACCCTCTCTACCCATCAGCTCGCGGCCTGTCT |
■■Homology search results ■■ |
- |
Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
sp_hit_id |
O65979 |
Definition |
sp|O65979|GGPS_SYNP2 Glucosylglycerol-phosphate synthase OS=Synechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6) |
Align length |
26 |
Score (bit) |
28.9 |
E-value |
8.4 |
Report |
|
TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
tr_hit_id |
- |
Definition |
No hits. |
Align length |
- |
Score (bit) |
- |
E-value |
- |
Report |
|