DK944535 | |
Clone id | YMU02A01NGRL0006_G08 |
Library | YMU02 |
Length | 172 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0006_G08. 5' end sequence. |
Accession | DK944535 |
Tissue type | young leaves |
Developmental stage | sporophyte |
Contig ID | CL193Contig1 |
Sequence | CAGTTAAAAAGCTCGTAGTTGGATCTCGGGGCGGGGCGAGCGGTCCGCCTCTTTTGGTGT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | P07645 |
Definition | sp|P07645|VGLD_SUHVR Protein gp50 OS=Suid herpesvirus 1 (strain Rice) |
Align length | 35 |
Score (bit) | 32.3 |
E-value | 0.74 |
Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | B6MF34 |
Definition | tr|B6MF34|B6MF34_BRAFL Putative uncharacterized protein OS=Branchiostoma floridae |
Align length | 45 |
Score (bit) | 43.5 |
E-value | 0.005 |
Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |