DK944726
Clone id YMU02A01NGRL0007_A07
Library
Length 177
Definition Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0007_A07. 5' end sequence.
Accession
Tissue type young leaves
Developmental stage sporophyte
Contig ID -
Sequence
GTTCACAGAACTCCCTCACGTGTCCTTTGCTTAGAAACGAGGGTAGGCACACCGCAACAA
AAAAAAAAAAAAAAAAAAAAAAAACAGTGTCGGCCGCCTCAGCCCAACCAGAAGCTTTCT
AAACCATTCTTTTGTCGCGAGGACCCAGAAGGTAACTTAACAAGGCCTTAGATGTTT
■■Homology search results ■■ -
sp_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= DK944726|Adiantum capillus-veneris mRNA, clone:
YMU02A01NGRL0007_A07, 5'
(177 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done

***** No hits found ******


tr_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= DK944726|Adiantum capillus-veneris mRNA, clone:
YMU02A01NGRL0007_A07, 5'
(177 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done

***** No hits found ******