DK944935 |
Clone id |
YMU02A01NGRL0007_K11 |
Library |
YMU02 |
Length |
163 |
Definition |
Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0007_K11. 5' end sequence. |
Accession |
DK944935 |
Tissue type |
young leaves |
Developmental stage |
sporophyte |
Contig ID |
CL1Contig2 |
Sequence |
AAGTCCTGGAAGAAAAGGGGGGCTTACCTACTAAATATCTGACGTGGCAGAAGGGATCTC CCAGAGACAAGAAGGGATGATATATTGGAACGACAAGCAGGGAGGAGAGAGAATTGGGCA AAAATGATGAATACAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
■■Homology search results ■■ |
- |
Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
sp_hit_id |
- |
Definition |
No hits. |
Align length |
- |
Score (bit) |
- |
E-value |
- |
Report |
 |
TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
tr_hit_id |
- |
Definition |
No hits. |
Align length |
- |
Score (bit) |
- |
E-value |
- |
Report |
 |