DK944964 | |
Clone id | YMU02A01NGRL0007_L21 |
Library | YMU02 |
Length | 644 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0007_L21. 5' end sequence. |
Accession | DK944964 |
Tissue type | young leaves |
Developmental stage | sporophyte |
Contig ID | - |
Sequence | AATGTTTTTTAGACATATACAAATCTAATGCCAGAAGACAGACTCACGCACTCCACTTTC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q5KP25 |
Definition | sp|Q5KP25|RSE1_CRYNE Pre-mRNA-splicing factor RSE1 OS=Cryptococcus neoformans |
Align length | 74 |
Score (bit) | 30.4 |
E-value | 7.3 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A9RPD5 |
Definition | tr|A9RPD5|A9RPD5_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
Align length | 106 |
Score (bit) | 69.3 |
E-value | 2.0e-10 |
Report | BLASTX 2.2.19 [Nov-02-2008] |