| DK944964 | |
| Clone id | YMU02A01NGRL0007_L21 |
| Library | YMU02 |
| Length | 644 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0007_L21. 5' end sequence. |
| Accession | DK944964 |
| Tissue type | young leaves |
| Developmental stage | sporophyte |
| Contig ID | - |
| Sequence | AATGTTTTTTAGACATATACAAATCTAATGCCAGAAGACAGACTCACGCACTCCACTTTC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q5KP25 |
| Definition | sp|Q5KP25|RSE1_CRYNE Pre-mRNA-splicing factor RSE1 OS=Cryptococcus neoformans |
| Align length | 74 |
| Score (bit) | 30.4 |
| E-value | 7.3 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A9RPD5 |
| Definition | tr|A9RPD5|A9RPD5_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
| Align length | 106 |
| Score (bit) | 69.3 |
| E-value | 2.0e-10 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |